Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
XRCC2-X-ray repair complementing defective repair in Chinese hamster cells 2 Gene
PTXBC042137
New product
Data sheet of XRCC2-X-ray repair complementing defective repair in Chinese hamster cells 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about XRCC2-X-ray repair complementing defective repair in Chinese hamster cells 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC042137 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | XRCC2 |
| Origin species: | Human |
| Product name: | XRCC2-X-ray repair complementing defective repair in Chinese hamster cells 2 Gene |
| Size: | 2ug |
| Accessions: | BC042137 |
| Gene id: | 7516 |
| Gene description: | X-ray repair complementing defective repair in Chinese hamster cells 2 |
| Synonyms: | DNA repair protein XRCC2; FANCU; X-ray repair complementing defective repair in Chinese hamster cells 2; X-ray repair cross-complementing protein 2; X-ray repair cross complementing 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgtagtgccttccatagggctgagtctgggaccgagctccttgcccgacttgaaggtagaagttccttgaaagaaatagaaccaaatctgtttgctgatgaagattcacctgtgcatggtgatattcttgaatttcatggcccagaaggaacaggaaaaacagaaatgctttatcacctaacagcacgatgtatacttcccaaatcagaaggtggcctggaagtagaagtcttatttattgatacagattaccactttgatatgctccggctagttacaattcttgagcacagactatcccaaagctctgaagaaataatcaaatactgcctgggaagattttttttggtgtactgcagtagtagcacccacttacttcttacactttactcactagaaagtatgttttgtagtcacccatctctctgccttttgattttggatagcctgtcagctttttactggatagaccgcgtcaatggaggagaaagtgtgaacttacaggagtctactctgaggaaatgttctcagtgcttagagaagcttgtaaatgactatcgcctggttctttttgcaacgacacaaactataatgcagaaagcctcgagctcatcagaagaaccttctcatgcctctcgacgactgtgtgatgtggacatagactacagaccttatctctgtaaggcatggcagcaactggtgaagcacaggatgtttttctccaaacaagatgattctcaaagcagcaaccaattttcattagtttcacgttgtttaaaaagtaacagtttaaaaaaacatttttttattattggagaaagtggggttgaattttgttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - X-ray repair complementing defective repair in Chinese hamster cells 1 - nascent-polypeptide-associated complex alpha polypeptide pseudogene 1 - apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H - solute carrier family 2 (facilitated glucose transporter), member 12 |