Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DCUN1D2-DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) Gene
PTXBC056669
New product
Data sheet of DCUN1D2-DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DCUN1D2-DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC056669 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DCUN1D2 |
| Origin species: | Human |
| Product name: | DCUN1D2-DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC056669 |
| Gene id: | 55208 |
| Gene description: | DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) |
| Synonyms: | C13orf17; DCN1-like protein 2; DCN1, defective in cullin neddylation 1, domain containing 2; DCUN1 domain-containing protein 2; defective in cullin neddylation protein 1-like protein 2; defective in cullin neddylation 1 domain containing 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcataagcttaaatcgtctcagaaggacaaggtccgccagtttatggcgtgcactcaggctggcgagagaactgctatctactgcttaacgcagaatgagtggagactagacgaggccacggacagcttcttccaaaacccagactcgctccacagggagtccatgcggaacgctgtggacaagaagaagctggagcggctgtacggcaggtacaaagatccacaagatgaaaacaaaattggagtcgatgggattcaacagttttgtgatgatctgagcctggatcctgccagtatcagtgtattggtcatagcgtggaagttcagggcagcaactcagtgtgaatttagcagaaaggaatttctagatggcatgacagaacttgggtgtgacagcatggagaagctaaaggctcttctgccaagactggagcaggagctgaaggacacagccaagtttaaagatttttatcagtttaccttcaccttcgctaagaacccagggcagaaaggtttagacttagaaatggctgttgcgtattggaaattagtgttatctggaaggtttaaatttttagatctctggaacacattcttaatggaacatcacaaaagatcaattccaagggacacctggaacctcctgctggactttggaaacatgattgcggatgatatgtctaactacgatgaagaaggagcttggcccgttcttatagatgattttgtagaatatgcacggccagtagtcacaggtggaaaacgcagccttttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase) - TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa - polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa - similar to metallo-beta-lactamase superfamily protein |