Cart 21 Product Products 3 463,72 € (empty)
-
1 x OLA1-Obg-l...121,50 € -
1 x IFI27-inte...113,40 € -
1 x C10orf111-...113,40 € -
1 x OGN-osteog...121,50 € -
1 x GDAP1L1-ga...121,50 € -
1 x NKIRAS2-NF...113,40 € -
-
1 x HBB-hemogl...113,40 € -
1 x HSPC152-hy...113,40 € -
1 x STT3B-STT3...113,40 € -
1 x GDE1-glyce...113,40 € -
-
1 x Visfatin...694,00 € -
1 x RGS4-regul...113,40 € -
1 x HBXIP-hepa...113,40 € -
-
-
1 x SERPINH1-s...121,50 € -
1 x C21orf122-...113,40 € -
1 x KLHDC3-kel...121,50 € -
1 x SERPINE2-s...121,50 €
No products
To be determined Shipping
3 463,72 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 21 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 463,72 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 463,72 €
Data sheet of CORO6-coronin 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CORO6-coronin 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064514 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CORO6 |
| Origin species: | Human |
| Product name: | CORO6-coronin 6 Gene |
| Size: | 2ug |
| Accessions: | BC064514 |
| Gene id: | 84940 |
| Gene description: | coronin 6 |
| Synonyms: | coronin-6; clipin-E; coronin, actin binding protein 6; coronin-like protein E; coronin 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgagtccctgggggtggtttgctgtgactgcatgcggcgcgcagcggaacaacttcgaggagccagtggcactgcaggagatggacacaagcaacggggtcctattgcccttttacgatcccgactccagcatcgtctacctgtgtggcaagggcgacagcagcattcggtactttgagattaccgacgagccgcctttcgtgcactacctgaacacgttcagcagcaaagagccgcagcggggcatgggtttcatgcccaaaaggggactggatgtcagcaagtgtgagatcgcccggttctacaagctacacgaaagaaagtgtgaacctatcatcatgactgtgccccgcaagtcagacctcttccaggacgatctgtacccggatacgccaggcccggagccggccctagaagcggacgaatggctatccggccaggacgccgaacccgtgctcatttcgctgagggacggctatgtgccccccaagcaccgcgagctccgggtcacgaagcgcaacatcctggacgtgcgcccgccctccggcccccgccgcagccagtcggccagcgacgcccccttgtcgcagcacaccctggagacgctgctggaagagatcaaggccctccgcgagcgggtgcaggcccaggagcagcgcatcacggctctggagaacatgctgtgcgagctggtggacggcacggactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - raptor - heparanase - oncomodulin - caveolin 3 |