No products
Prices are tax excluded
PTXBC062707
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC062707 |
Product type: | DNA & cDNA |
Ncbi symbol: | TIMM23 |
Origin species: | Human |
Product name: | TIMM23-translocase of inner mitochondrial membrane 23 homolog (yeast) Gene |
Size: | 2ug |
Accessions: | BC062707 |
Gene id: | 10431 |
Gene description: | translocase of inner mitochondrial membrane 23 homolog (yeast) |
Synonyms: | Tim23; mitochondrial import inner membrane translocase subunit Tim23; translocase of inner mitochondrial membrane 23 homolog; translocase of inner mitochondrial membrane 23 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggaaggaggcgggggaagcggcaacaaaaccacagggggattggccggctttttcggagccggcggagcaggttactcgcacgcggatttggctggcgtcccgctaactggtatgaaccctctgtctccttatttaaatgtggatccacgatacctcgtgcaggatacagatgagtttatacctaccggagctaataaaacccggggcagatttgagctggccttctttacgattggaggatgttgcatgacaggggctgcgtttggtgcaatgaatggtcttcggctaggattgaaggaaacccagaacatggcctggtccaaaccaagaaatgtacagattttgaatatggtgactaggcaaggggcactttgggctaatactctaggttctctggctttgctctatagtgcatttggtgtcatcattgagaaaacacgaggtgcagaagatgaccttaacacagtagcagctggaaccatgacaggcatgttgtataaatgtacaggtggtcttcgagggatagcacgaggtggtctgacaggactaacacttaccagcctctatgcactatataataactgggagcacatgaaaggctccttgctccaacagtcactctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - proteasome (prosome, macropain) activator subunit 2 (PA28 beta) - PAN2 polyA specific ribonuclease subunit homolog (S. cerevisiae) - serpin peptidase inhibitor, clade G (C1 inhibitor), member 1 - membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) |