Cart 1 Product Products 113,40 € (empty)
-
1 x JOSD1-Jose...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
TIMM23-translocase of inner mitochondrial membrane 23 homolog (yeast) Gene
PTXBC062707
New product
Data sheet of TIMM23-translocase of inner mitochondrial membrane 23 homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIMM23-translocase of inner mitochondrial membrane 23 homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062707 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMM23 |
| Origin species: | Human |
| Product name: | TIMM23-translocase of inner mitochondrial membrane 23 homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC062707 |
| Gene id: | 10431 |
| Gene description: | translocase of inner mitochondrial membrane 23 homolog (yeast) |
| Synonyms: | Tim23; mitochondrial import inner membrane translocase subunit Tim23; translocase of inner mitochondrial membrane 23 homolog; translocase of inner mitochondrial membrane 23 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaggaggcgggggaagcggcaacaaaaccacagggggattggccggctttttcggagccggcggagcaggttactcgcacgcggatttggctggcgtcccgctaactggtatgaaccctctgtctccttatttaaatgtggatccacgatacctcgtgcaggatacagatgagtttatacctaccggagctaataaaacccggggcagatttgagctggccttctttacgattggaggatgttgcatgacaggggctgcgtttggtgcaatgaatggtcttcggctaggattgaaggaaacccagaacatggcctggtccaaaccaagaaatgtacagattttgaatatggtgactaggcaaggggcactttgggctaatactctaggttctctggctttgctctatagtgcatttggtgtcatcattgagaaaacacgaggtgcagaagatgaccttaacacagtagcagctggaaccatgacaggcatgttgtataaatgtacaggtggtcttcgagggatagcacgaggtggtctgacaggactaacacttaccagcctctatgcactatataataactgggagcacatgaaaggctccttgctccaacagtcactctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) activator subunit 2 (PA28 beta) - PAN2 polyA specific ribonuclease subunit homolog (S. cerevisiae) - serpin peptidase inhibitor, clade G (C1 inhibitor), member 1 - membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) |