> >>VHL-von Hippel-Lindau tumor suppressor Gene
VHL-von Hippel-Lindau tumor suppressor Gene View larger

VHL-von Hippel-Lindau tumor suppressor Gene

PTXBC058831

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of VHL-von Hippel-Lindau tumor suppressor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VHL-von Hippel-Lindau tumor suppressor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC058831
Product type: DNA & cDNA
Ncbi symbol: VHL
Origin species: Human
Product name: VHL-von Hippel-Lindau tumor suppressor Gene
Size: 2ug
Accessions: BC058831
Gene id: 7428
Gene description: von Hippel-Lindau tumor suppressor
Synonyms: HRCA1; RCA1; VHL1; pVHL; von Hippel-Lindau disease tumor suppressor; elongin binding protein; protein G7; von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase; von Hippel-Lindau tumor suppressor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccccggagggcggagaactgggacgaggccgaggtaggcgcggaggaggcaggcgtcgaagagtacggccctgaagaagacggcggggaggagtcgggcgccgaggagtccggcccggaagagtccggcccggaggaactgggcgccgaggaggagatggaggccgggcggccgcggcccgtgctgcgctcggtgaactcgcgcgagccctcccaggtcatcttctgcaatcgcagtccgcgcgtcgtgctgcccgtatggctcaacttcgacggcgagccgcagccctacccaacgctgccgcctggcacgggccgccgcatctacagctaccgagtgtatactctgaaagagcgatgcctccaggttgtccggagcctagtcaagcctgagaattacaggagactggacatcgtcaggtcgctctacgaagatctggaagaccacccaaatgtgcagaaagacctggagcggctgacacaggagcgcattgcacatcaacggatgggagattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thioredoxin domain containing 5
- transducin (beta)-like 1X-linked
- peroxisomal biogenesis factor 13
- WAP four-disulfide core domain 9

Reviews

Buy VHL-von Hippel-Lindau tumor suppressor Gene now

Add to cart