MTP18-mitochondrial protein 18 kDa Gene

View larger

MTP18-mitochondrial protein 18 kDa Gene

Reference: PTXBC001608

Condition: New product

Print

Data sheet of MTP18-mitochondrial protein 18 kDa Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about MTP18-mitochondrial protein 18 kDa Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC001608
Product type:	DNA & cDNA
Ncbi symbol:	MTP18
Origin species:	Human
Product name:	MTP18-mitochondrial protein 18 kDa Gene
Size:	2ug
Accessions:	BC001608
Gene id:	51537
Gene description:	mitochondrial protein 18 kDa
Synonyms:	mitochondrial fission protein MTP18; MTP18; HSPC242; mitochondrial fission process protein 1; mitochondrial 18 kDa protein; mitochondrial protein 18 kDa; mitochondrial fission process 1
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgtcagagccgcagccgcggggcgcagagcgcgatctctaccgggacacgtgggtgcgatacctgggctatgccaatgaggtgggcgaggctttccgctctcttgtgccagcggcggtggtgtggctgagctatggcgtggccagctcctacgtgctggcggatgccattgacaaaggcaagaaggctggagaggtgcccagccctgaagcaggccgcagcgccagggtgaccgtggctgtggtggacacctttgtatggcaggctctagcctctgtggccattccgggcttcaccatcaaccgcgtgtgtgctgcctctctctatgtcctgggcactgccacccgctggcccctggctgtccgcaagtggaccaccaccgcgcttgggctgttgaccatccccatcattatccaccccattgacaggtcggtggatttcctcctggactccagcctgcgcaagctctacccaacagtggggaagcccagctcctcctga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- immunoglobulin kappa constant - integrator complex subunit 4 - C-terminal binding protein 1 - SAPS domain family, member 2

Reviews

Be the first to write your review !

Buy MTP18-mitochondrial protein 18 kDa Gene now