PTXBC042127
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC042127 |
Product type: | DNA & cDNA |
Ncbi symbol: | IGF2 |
Origin species: | Human |
Product name: | IGF2-insulin-like growth factor 2 (somatomedin A) Gene |
Size: | 2ug |
Accessions: | BC042127 |
Gene id: | 3481 |
Gene description: | insulin-like growth factor 2 (somatomedin A) |
Synonyms: | C11orf43; GRDF; IGF-II; PP9974; insulin-like growth factor II; T3M-11-derived growth factor; insulin-like growth factor 2 (somatomedin A); insulin-like growth factor type 2; preptin; insulin like growth factor 2 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaccccgggggtcgtccatgccagtccgcctcagtcgcagagggtccctcggcaagcgccctgtgagtgggccattcggaacattggacagaagcccaaagagccaaattgtcacaattgtggaacccacattggcctgagatccaaaacgcttcgaggcaccccaaattacctgcccattcgtcaggacacccacccacccagtgttatattctgcctcgccggagtgggtgttcccgggggcacttgccgaccagccccttgcgtccccaggtttgcagctctcccctgggccactaaccatcctggcccgggctgcctgtctgacctccgtgcctag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - heat shock transcription factor, Y-linked 1 - hyaluronan and proteoglycan link protein 3 - 5-hydroxytryptamine (serotonin) receptor 2B - calcium and integrin binding family member 3 |