Cart 18 Product Products 2 137,65 € (empty)
-
-
1 x MRPL20-mit...113,40 € -
1 x HIST1H4J-h...113,40 € -
1 x KLC3-kines...113,40 € -
1 x C17orf54-c...113,40 € -
1 x ERAF-eryth...113,40 € -
-
1 x PMPCB-pept...121,50 € -
1 x COMT-catec...113,40 € -
-
1 x MGC15634-h...113,40 € -
1 x HIST2H4B-h...113,40 € -
1 x SNRNP35-sm...113,40 € -
1 x C8orf74-ch...121,50 € -
1 x TAF8-TAF8...113,40 € -
1 x GSTO2-glut...113,40 € -
-
No products
To be determined Shipping
2 137,65 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 18 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 137,65 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 137,65 €
Data sheet of ZNF718-zinc finger protein 718 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZNF718-zinc finger protein 718 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC052600 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZNF718 |
| Origin species: | Human |
| Product name: | ZNF718-zinc finger protein 718 Gene |
| Size: | 2ug |
| Accessions: | BC052600 |
| Gene id: | 255403 |
| Gene description: | zinc finger protein 718 |
| Synonyms: | zinc finger protein 718 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaactcttaacattcaaggatgtggccatagaattctctccagaagagtggaaatgtctggacatttcccagcagaatttatatagagatgtgatgttggagaactacagaaacctggtctccctgggtgttactatctctaacccagacctggtcaccagtctggagcaaagaaaagagccctacaatttgaagatacatgaaacagcagccagacccccagtgatctcccttcaagtttacagggagtgccagtgtccactttatcacttacaaagggctacatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger protein 695 - fuzzy homolog (Drosophila) - zinc finger protein 483 - cyclin-dependent kinase 6 |