> >>FLJ40125-hypothetical protein FLJ40125 Gene
FLJ40125-hypothetical protein FLJ40125 Gene View larger

FLJ40125-hypothetical protein FLJ40125 Gene

PTXBC062452

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of FLJ40125-hypothetical protein FLJ40125 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FLJ40125-hypothetical protein FLJ40125 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC062452
Product type: DNA & cDNA
Ncbi symbol: FLJ40125
Origin species: Human
Product name: FLJ40125-hypothetical protein FLJ40125 Gene
Size: 2ug
Accessions: BC062452
Gene id: 147699
Gene description: hypothetical protein FLJ40125
Synonyms: protein phosphatase, Mg2+/Mn2+ dependent 1N (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacctgcatcctggtctgcttccctggggcccctaggccttctgaggaggcgatcaggagggagctagcactggacgcagccctgggctgcagaatcgctgaactgtgtgcctctgctcagaagccccccagcctgaacacagttttcaggactctggcctcagaggacatcccagatttacctcctgggggagggctggactgcaaggccactgtcattgctgaagtttattctcagatctgccaggtctcagaagagtgcggagagaaggggcaggatggggctgggaagtccaaccccacgcatttgggctcagccttggacatggaggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - von Hippel-Lindau tumor suppressor
- thioredoxin domain containing 5
- transducin (beta)-like 1X-linked
- peroxisomal biogenesis factor 13

Reviews

Buy FLJ40125-hypothetical protein FLJ40125 Gene now

Add to cart