Cart 4 Product Products 547,71 € (empty)
-
1 x PRPF38B-PR...113,40 € -
1 x VCY-variab...113,40 € -
1 x FAM154A-fa...121,50 € -
No products
To be determined Shipping
547,71 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 547,71 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 547,71 €
View larger 
LATS1-LATS, large tumor suppressor, homolog 1 (Drosophila) Gene
PTXBC015665
New product
Data sheet of LATS1-LATS, large tumor suppressor, homolog 1 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LATS1-LATS, large tumor suppressor, homolog 1 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015665 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LATS1 |
| Origin species: | Human |
| Product name: | LATS1-LATS, large tumor suppressor, homolog 1 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC015665 |
| Gene id: | 9113 |
| Gene description: | LATS, large tumor suppressor, homolog 1 (Drosophila) |
| Synonyms: | serine/threonine-protein kinase LATS1; WARTS; wts; LATS (large tumor suppressor, Drosophila) homolog 1; LATS, large tumor suppressor, homolog 1; WARTS protein kinase; h-warts; large tumor suppressor homolog 1; large tumor suppressor kinase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagaggagtgaaaagccagaaggatatagacaaatgaggcctaagacctttcctgccagtaactatactgtcagtagccggcaaatgttacaagaaattcgggaatcccttaggaatttatctaaaccatctgatgctgctaaggctgagcataacatgagtaaaatgtcaaccgaagatcctcgacaagtcagaaatccacccaaatttgggacgcatcataaagccttgcaggaaattcgaaactctctgcttccatttgcaaatgaaacaaattcttctcggagtacttcagaagttaatccacaaatgcttcaagacttgcaagctgctggatttgatgaggaggatcatctgtcagtagcctgttcacccattagtcttactaagccatttctcatttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - similar to mitochondrial carrier triple repeat 1 - regulation of nuclear pre-mRNA domain containing 1A - calcium channel, voltage-dependent, gamma subunit 2 - membrane-spanning 4-domains, subfamily A, member 6E |