Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HDHD2-haloacid dehalogenase-like hydrolase domain containing 2 Gene
PTXBC011894
New product
Data sheet of HDHD2-haloacid dehalogenase-like hydrolase domain containing 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HDHD2-haloacid dehalogenase-like hydrolase domain containing 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011894 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HDHD2 |
| Origin species: | Human |
| Product name: | HDHD2-haloacid dehalogenase-like hydrolase domain containing 2 Gene |
| Size: | 2ug |
| Accessions: | BC011894 |
| Gene id: | 84064 |
| Gene description: | haloacid dehalogenase-like hydrolase domain containing 2 |
| Synonyms: | 3110052N05Rik; HEL-S-301; haloacid dehalogenase-like hydrolase domain-containing protein 2; epididymis secretory protein Li 301; haloacid dehalogenase like hydrolase domain containing 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgctagttgatgatcgggcactacctgatttcaaaggaatacaaacaagtgatcctaatgctgtggtcatgggattggcaccagaacattttcattatcaaattctgaatcaagcattccggttactcctggatggagcacctctgatagcaatccacaaagccaggtattacaagaggaaagatggcttagccctggggcctggaccatttgtgactgctttagagtatgccacagataccaaagccacagtcgtggggaaaccagagaagacgttctttttggaagcattgcggggcactggctgtgaacctgaggaggctgtcatgataggagatgattgcagggatgatgttggtggggctcaagatgtcggcatgctgggcatcttagtaaagactgggaaatatcgagcatcagatgaagaaaaaattaatccacctccttacttaacttgtgagagtttccctcatgctgtggaccacattctgcagcacctattgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATP synthase mitochondrial F1 complex assembly factor 2 - secretion regulating guanine nucleotide exchange factor - DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) - cytochrome P450, family 26, subfamily B, polypeptide 1 |