ZNF695-zinc finger protein 695 Gene View larger

ZNF695-zinc finger protein 695 Gene

PTXBC023527

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF695-zinc finger protein 695 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF695-zinc finger protein 695 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC023527
Product type: DNA & cDNA
Ncbi symbol: ZNF695
Origin species: Human
Product name: ZNF695-zinc finger protein 695 Gene
Size: 2ug
Accessions: BC023527
Gene id: 57116
Gene description: zinc finger protein 695
Synonyms: SBZF3; zinc finger protein 695; zinc finger protein SBZF3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggactattggcattcagggatgtggctctagaattctctccagaggagtgggaatgcctggacccagctcagcggagtttgtatagggatgtgatgttagagaactacagaaacctgatctcccttggtgaggatagcttcaatatgcaattcctatttcacagtcttgctatgtctaagccagaactgatcatctgtctggaggcaaggaaagagccctggaacgtgaacacagagaagacagccaaacactcagctttgtcttcttatcttactgaagacattttgccagagcagggcctgcaagtttcattccaaaaagtgatgctgagaagatatgaaagatgttgtcttgagaaattacgcttaaggaatgactgggaaattgtggccatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 718
- zinc finger protein 695
- fuzzy homolog (Drosophila)
- zinc finger protein 483

Reviews

Buy ZNF695-zinc finger protein 695 Gene now

Add to cart