PTXBC012018
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC012018 |
Product type: | DNA & cDNA |
Ncbi symbol: | FAM100A |
Origin species: | Human |
Product name: | FAM100A-family with sequence similarity 100, member A Gene |
Size: | 2ug |
Accessions: | BC012018 |
Gene id: | 124402 |
Gene description: | family with sequence similarity 100, member A |
Synonyms: | protein FAM100A; FAM100A; PP11303; UBA-like domain-containing protein 1; family with sequence similarity 100, member A; UBA like domain containing 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgtccgtgaacatggacgagctcaagcaccaggtcatgatcaaccagttcgtgctgacggcgggctgcgcggccgaccaggcgaagcaactgctgcaggcggcccactggcagttcgagacagccctcagcgcctttttccaggagaccaacatcccctacagccaccatcaccaccagatgatgtgcacccccgccaatacccctgctacaccccccaacttccctgacgctctcaccatgttctcccgtctcaaggcctccgagagcttccacagcggtggcagcggcagcccgatggccgcgacagccacgtcacccccgccacacttcccccatgccgccaccagcagctctgcggcctccagctggcccacggcggcctcgcccccggggggcccacagcaccaccagccacagccgcccctgtggactccaacacccccttctccggcttcagactggccacccctggccccccaacaggccacctcagaacccagggcccaccctgccatggaggcagagagataa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - family with sequence similarity 105, member B - N-acetyltransferase 11 (GCN5-related, putative) - erythrocyte membrane protein band 4.9 (dematin) - ring finger and CCCH-type zinc finger domains 2 |