Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ANTXR2-anthrax toxin receptor 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ANTXR2-anthrax toxin receptor 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034001 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ANTXR2 |
| Origin species: | Human |
| Product name: | ANTXR2-anthrax toxin receptor 2 Gene |
| Size: | 2ug |
| Accessions: | BC034001 |
| Gene id: | 118429 |
| Gene description: | anthrax toxin receptor 2 |
| Synonyms: | CMG-2; CMG2; HFS; ISH; JHF; anthrax toxin receptor 2; capillary morphogenesis gene 2 protein; capillary morphogenesis protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggtggttttggcccctttgctgcaaagtggttattaaggatcctccaccaccacccccccctgcaccaaaagaggaggaagaagaacctttgcctactaaaaagtggccaactgtggatgcttcctattatggtggtcgaggggttggaggaattaaaagaatggaggttcgttggggtgataaaggatctactgaggaaggtgcaaggctagagaaagccaaaaatgctgtggtgaagattcctgaagaaacagaggaacccatcaggcctagaccacctcgacccaaacccacacaccagcctcctcagacaaaatggtacaccccaattaagggtcgtcttgatgctctctgggctttgttgaggcggcagtatgaccgggtttctttgatgcgacctcaggaaggagatgagggccggtgcataaacttctcccgagttccatctcagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - T-cell leukemia/lymphoma 6 - nucleolar protein 7, 27kDa - ectodysplasin A2 receptor - NADPH oxidase activator 1 |