Cart 1 Product Products 113,40 € (empty)
-
1 x JOSD1-Jose...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
Data sheet of GOLT1A-golgi transport 1 homolog A (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GOLT1A-golgi transport 1 homolog A (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC058832 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GOLT1A |
| Origin species: | Human |
| Product name: | GOLT1A-golgi transport 1 homolog A (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC058832 |
| Gene id: | 127845 |
| Gene description: | golgi transport 1 homolog A (S. cerevisiae) |
| Synonyms: | CGI-141; GOT1; HMFN1187; YMR292W; hGOT1b; vesicle transport protein GOT1A; golgi transport 1A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatctccatcaccgaatggcagaagattggtgtggggatcaccggtttcggcatcttcttcatcctctttggaacactcctgtactttgattccgtgctcctggcctttggaaacctgctgttcctgacgggcctgtccctcatcattggcctgaggaagaccttttggttcttcttccaacggcacaaactcaagggaaccagcttcctcctggggggtgtggttatcgtgctcctacgctggcccctcctcggcatgttcctggaaacctacggattcttcagcctctttaagggctttttccctgtcgccttcggcttcctgggcaatgtctgcaacatccccttcctgggtgcgctgttccggagacttcaaggcactagctcgatggtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily C, member 2 - DnaJ (Hsp40) homolog, subfamily C, member 7 - aldehyde dehydrogenase 3 family, member B1 - p53-regulated apoptosis-inducing protein 1 |