Cart 12 Product Products 1 716,80 € (empty)
-
-
1 x ZBTB43-zin...121,50 € -
1 x BCAT2-bran...121,50 € -
1 x FLJ32063-h...113,40 € -
1 x LSM2-LSM2...113,40 € -
1 x THEX1-thre...121,50 € -
-
1 x C14orf94-c...121,50 € -
1 x SIAH1-seve...121,50 € -
1 x PHC2-polyh...121,50 € -
1 x NUF2-NUF2,...121,50 € -
1 x SLC25A31-s...121,50 €
No products
To be determined Shipping
1 716,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 716,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 716,80 €
Data sheet of LIAS-lipoic acid synthetase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LIAS-lipoic acid synthetase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062751 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LIAS |
| Origin species: | Human |
| Product name: | LIAS-lipoic acid synthetase Gene |
| Size: | 2ug |
| Accessions: | BC062751 |
| Gene id: | 11019 |
| Gene description: | lipoic acid synthetase |
| Synonyms: | HGCLAS; HUSSY-01; LAS; LIP1; PDHLD; lipoyl synthase, mitochondrial; lip-syn; lipoate synthase; lipoic acid synthetase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctctacgctgcggggatgcagcccgcaccctggggccccgggtatttgggagatatttttgcagcccagtcagaccgttaagctccttgccagataaaaaaaaggaactcctacagaatggaccagaccttcaagattttgtatctggtgatcttgcagacaggagcacctgggatgaatataaaggaaacctaaaacgccagaaaggagaaaggttaagactacctccatggctaaagacagagattcccatggggaaaaattacaataaactgaaaaatactttgcggaatttaaatctccatacagtatgtgaggaagctcgatgtcccaatattggagagtgttggggaggtggagaatatgccaccgccacagccacgatcatggtagggccagcctcaacctctatggctttagtctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein L23 - interleukin 9 receptor - glycyl-tRNA synthetase - carbonic anhydrase VIII |