ZNF808-zinc finger protein 808 Gene View larger

ZNF808-zinc finger protein 808 Gene

PTXBC017109

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF808-zinc finger protein 808 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF808-zinc finger protein 808 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017109
Product type: DNA & cDNA
Ncbi symbol: ZNF808
Origin species: Human
Product name: ZNF808-zinc finger protein 808 Gene
Size: 2ug
Accessions: BC017109
Gene id: 388558
Gene description: zinc finger protein 808
Synonyms: zinc finger protein 808
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattgtggcaaagcctttacttcacattcacacctcgttggacatcagagaatccatactggacagaaatcttgcaaatgtcatcagtgtggcaaggtcttcagtccgaggtcactccttgcagaacatgagaaaattcatttttgagataactgttcccaatgcagtgagtatagcaaaccatcaagcattaattgacattggagtcaattcagcattgacttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 468
- zinc finger protein 695
- zinc finger protein 695
- zinc finger protein 718

Reviews

Buy ZNF808-zinc finger protein 808 Gene now

Add to cart