Cart 3 Product Products 971,28 € (empty)
-
-
1 x Uromodulin744,00 € -
No products
To be determined Shipping
971,28 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 971,28 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 971,28 €
View larger 
CYP4B1-cytochrome P450, family 4, subfamily B, polypeptide 1 Gene
PTXBC017758
New product
Data sheet of CYP4B1-cytochrome P450, family 4, subfamily B, polypeptide 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CYP4B1-cytochrome P450, family 4, subfamily B, polypeptide 1 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC017758 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CYP4B1 |
| Origin species: | Human |
| Product name: | CYP4B1-cytochrome P450, family 4, subfamily B, polypeptide 1 Gene |
| Size: | 2ug |
| Accessions: | BC017758 |
| Gene id: | 1580 |
| Gene description: | cytochrome P450, family 4, subfamily B, polypeptide 1 |
| Synonyms: | CYPIVB1; P-450HP; cytochrome P450 4B1; cytochrome P450, family 4, subfamily B, polypeptide 1; cytochrome P450, subfamily IVB, polypeptide 1; cytochrome P450-HP; microsomal monooxygenase; cytochrome P450 family 4 subfamily B member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgcccagcttcctctccctgagcttctcctccttgggcctgtgggcttctgggctgatcttggtcttaggctttctcaagctcatccacctgctgctgcggaggcagacgttggctaaggctatggacaaattcccagggcctcccacccactggctttttggacatgccctcgagatccaggagacggggagcctggacaaagtggtgtcctgggcccaccagttcccgtatgcccacccactctggttcggacagttcattggcttcctgaacatctatgagcctgactatgccaaagctgtgtacagccgtggggaccctaaggcccctgatgtgtatgacttcttcctccagtggattgggagaggcctgctggttcttgaggggcccaagtggttgcagcaccgcaagctgctcacacctggctttcattatgatgtgctgaagccctatgtggccgtgttcactgagtctacacgtatcatgctggacaagtgggaagagaaagctcgggagggtaagtcctttgacatcttctgcgatgtgggtcacatggcgctgaacacactcatgaagtgcacctttggaagaggagacaccggcctgggccacagcagggacagcagctactaccttgcagtcagcgatctcactctgttgatgcagcagcgccttgtgtccttccagtaccataatgacttcatctactggctcaccccacatggccgccgcttcctgcgggcctgccaggtggcccatgaccatacagaccaggtcatcagggagcggaaggcagccctgcaggatgagaaggtgcggaagaagatccagaaccggaggcacctggacttcctggacattctcctgggtgcccgggatgaagatgacatcaaactgtcagatgcagacctccgggctgaagtggacacattcatgtttgaaggccatgacaccaccaccagtggtatctcctggtttctctactgcatggccctgtaccctgagcaccagcatcgttgtagagaggaggtccgcgagatcctaggggaccaggacttcttccagtgggatgatctgggcaaaatgacttatctgaccatgtgcatcaaggagagcttccgcctctacccacctgtgccccaggtgtaccgccagctcagcaagcctgtcacctttgtggatggccggtctctacctgcaggaagcctgatctctatgcatatctatgccctccataggaacagtgctgtatggcccgaccctgaggtctttgactctctgcgcttttccactgagaatgcatccaaacgccatccctttgcctttatgcccttctctgctgggcccaggaactgcattgggcagcagtttgccatgagtgagatgaaggtggtcacagccatgtgcttgctccgctttgagttctctctggacccctcacggctgcccatcaagatgccccagcttgtcctgcgctccaagaatggctttcacctccacctgaagccactgggccctgggtctgggaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dehydrogenase/reductase (SDR family) member 4 like 2 - killer cell lectin-like receptor subfamily C, member 1 - Bernardinelli-Seip congenital lipodystrophy 2 (seipin) - killer cell lectin-like receptor subfamily A, member 1 |