Cart 16 Product Products 2 418,19 € (empty)
-
1 x Cortisol...339,00 € -
-
1 x KLK10-kall...121,50 € -
-
-
-
1 x HMGN1-high...113,40 € -
1 x ZIM3-zinc...121,50 € -
-
1 x MYL6B-myos...113,40 € -
-
-
-
-
1 x STK32B-ser...121,50 € -
No products
To be determined Shipping
2 418,19 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 16 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 418,19 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 418,19 €
Data sheet of FTO-fat mass and obesity associated Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FTO-fat mass and obesity associated Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003583 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FTO |
| Origin species: | Human |
| Product name: | FTO-fat mass and obesity associated Gene |
| Size: | 2ug |
| Accessions: | BC003583 |
| Gene id: | 79068 |
| Gene description: | fat mass and obesity associated |
| Synonyms: | FTO, alpha-ketoglutarate dependent dioxygenase; alpha-ketoglutarate-dependent dioxygenase FTO; ALKBH9; BMIQ14; GDFD; AlkB homolog 9; fat mass and obesity associated; fat mass and obesity-associated protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcatgccagggcagagaggagtgttggtgccagtcacgaattgcccgaacattacctgctgatcagaagccagaatgtcggccatactgggaaaaggatgatgcttcgatgcctctgccgtttgacctcacagacatcgtttcagaactcagaggtcagcttctggaagcaaaaccctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - spermatogenesis associated 6 - HMG-box transcription factor 1 - suppression of tumorigenicity 7 - nucleophosmin/nucleoplasmin, 3 |