Cart 4 Product Products 446,47 € (empty)
-
1 x C2orf76-ch...113,40 € -
1 x BCL7C-B-ce...113,40 € -
-
1 x C6orf208-c...113,40 €
No products
To be determined Shipping
446,47 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 446,47 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 446,47 €
Data sheet of NIT2-nitrilase family, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NIT2-nitrilase family, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020620 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NIT2 |
| Origin species: | Human |
| Product name: | NIT2-nitrilase family, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC020620 |
| Gene id: | 56954 |
| Gene description: | nitrilase family, member 2 |
| Synonyms: | omega-amidase NIT2; HEL-S-8a; Nit protein 2; epididymis secretory sperm binding protein Li 8a; nitrilase homolog 2; nitrilase family member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacctctttccgcttggccctcatccagcttcagatttcttccatcaaatcagataacgtcactcgcgcttgtagcttcatccgggaggcagcaacgcaaggagccaaaatagtttctttgccggaatgctttaattctccatatggagcgaaatattttcctgaatatgcagagaaaattcctggtgaatccacacagaagctttctgaagtagcaaaggaatgcagcatatatctcattggaggctctatccctgaagaggatgctgggaaattatataacacctgtgctgtgtttgggcctgatggaactttactagcaaagtatagaaagatccatctgtttgacattgatgttcctggaaaaattacatttcaagaatctaaaacattgagtccgggtgatagtttctccacatttgatactccttactgcagagtgggtctgggcatctgctacgacatgcggtttgcagagcttgcacaaatctacgcacagagaggctgccagctgttggtatatccaggagcttttaatctgaccactggaccagcccattgggagttacttcagcgaagccgggctgttgataatcaggtgtatgtggccacagcctctcctgcccgggatgacaaagcctcctatgttgcctggggacacagcaccgtggtgaacccttggggggaggctctagccaaagctggcacagaagaagcaatcgtgtattcagacatagacctgaagaagctggctgaaatacgccagcaaatccccgtttttagacagaagcgatcagacctctatgctgtggagatgaaaaagccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RWD domain containing 2B - fatty acyl CoA reductase 2 - HEAT repeat containing 1 - histone cluster 1, H4c |