Cart 32 Product Products 5 172,78 € (empty)
-
1 x C10orf97-c...121,50 € -
1 x Ameloblast...259,07 € -
-
1 x HERPUD1-ho...121,50 € -
1 x OLAH-oleoy...113,40 € -
1 x HDHD2-halo...113,40 € -
1 x GGTA1-glyc...113,40 € -
-
1 x CRB3-crumb...113,40 € -
1 x HDHD1A-hal...113,40 € -
-
-
1 x PPIE-pepti...121,50 € -
1 x USP25-ubiq...121,50 € -
-
1 x SERPINE2-s...121,50 € -
1 x PTPRCAP-pr...113,40 € -
-
-
-
1 x Cleaved-La...259,07 € -
-
-
-
1 x SERPINB4-s...121,50 € -
1 x CCNG1-cycl...121,50 € -
1 x GEFT-RhoA/...121,50 € -
1 x FADD-Fas...113,40 € -
1 x ANKRD39-an...113,40 € -
1 x ANG-angiog...113,40 € -
1 x HSL...259,07 € -
No products
To be determined Shipping
5 172,78 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 32 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 172,78 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 172,78 €
Data sheet of IYD-iodotyrosine deiodinase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IYD-iodotyrosine deiodinase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC056253 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IYD |
| Origin species: | Human |
| Product name: | IYD-iodotyrosine deiodinase Gene |
| Size: | 2ug |
| Accessions: | BC056253 |
| Gene id: | 389434 |
| Gene description: | iodotyrosine deiodinase |
| Synonyms: | IYD-1; C6orf71; TDH4; iodotyrosine deiodinase 1; iodotyrosine dehalogenase 1; iodotyrosine deiodinase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtatttcctgactcccatcttggtagccattctctgcattttggttgtgtggatctttaaaaatgccgacagaagcatggagaaaaagaagggggagcctagaaccagggccgaagctcgcccctgggtggatgaagacttaaaagacagcagtgacctgcaccaagcagaagaagatgctgatgaatggcaagaatcagaagaaaatgttgaacacatccccttctctcataaccactatcctgagaaggaaatggttaagaggtctcaggaattttatgaacttctcaataagagacggtcagtcaggttcataagtaatgagcaagtcccaatggaagtcattgataatgtcatcagaacggcaggaacagccccgagtggggctcacacagagccctggaccttcgtggttgtgaaggacccagacgtgaagcacaagattcgaaagatcattgaggaggaagaggagatcaactacatgaaaaggatgggacatcgctgggtcacagacctcaagaaactgagaaccaactggattaaagagtacttggatactgcccctattttgattctcattttcaaacaagtacatggtttcgccgcaaatggcaagaaaaaagtccactactacaatgagatcagtgtttccatcgcttgtggcatcctgctagctgccctgcagaatgcaggtctggtgactgtcactaccactcctctcaactgtggccctcgactgagggtgctcctgggccgccccgcacatgaaaagctgccgatgctgctccccgtggggtaccccagcaaggaggccacggtgcctgacctcaagcgcaaacctctggaccagatcatggtgacagtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - succinate receptor 1 - peptidase inhibitor 16 - angiopoietin-like 3 - lipoic acid synthetase |