Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC35A1-solute carrier family 35 (CMP-sialic acid transporter), member A1 Gene
PTXBC017807
New product
Data sheet of SLC35A1-solute carrier family 35 (CMP-sialic acid transporter), member A1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC35A1-solute carrier family 35 (CMP-sialic acid transporter), member A1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017807 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC35A1 |
| Origin species: | Human |
| Product name: | SLC35A1-solute carrier family 35 (CMP-sialic acid transporter), member A1 Gene |
| Size: | 2ug |
| Accessions: | BC017807 |
| Gene id: | 10559 |
| Gene description: | solute carrier family 35 (CMP-sialic acid transporter), member A1 |
| Synonyms: | CDG2F; CMPST; CST; hCST; CMP-sialic acid transporter; CMP-SA-Tr; CMP-Sia-Tr; mutated CMP-sialic acid transporter A1; solute carrier family 35 (CMP-sialic acid transporter), member 1; solute carrier family 35 (CMP-sialic acid transporter), member A1; solute carrier family 35 (UDP-galactose transporter), member 1; solute carrier family 35 member A1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgccccgagagacaatgtcactttattattcaagttatactgcttggcagtgatgaccctgatggctgcagtctataccatagctttaagatacacaaggacatcagacaaagaactctacttttcaaccacagccgtgtgtatcacagaagttataaagttattgctaagtgtgggaattttagctaaagaaactggtagtctgggtagattcaaagcatctttaagagaaaatgtcttggggagccccaaggaactgttgaagttaagtgtgccatcgttagtgtatgctgttcagaacaacatggctttcctagctcttagcaatctggatgcagcagtgtaccaggtgacctaccagttgaagattccgtgtactgctttatgcactgttttaatgttaaaccggacactcagcaaattacagtgggtttcagtttttatgctgtgtgctggagttacgcttgtacagtggaaaccagcccaagctacaaaagtggtggtggaacaaaatccattattagggtttggcgctatagctattgctgtattgtgctcaggatttgcaggagtatattttgaaaaagttttaaagagttcagatacttctctttgggtgagaaacattcaaatgtatctatcagggattattgtgacattagctggcgtctacttgtcagatggagctgaaattaaagaaaaaggatttttctatggttacacatattatgtctggtttgtcatctttcttgcaagtgttggtggcctctacacttctgttgtggttaagtacacagacaacatcatgaaaggcttttctgcagcagcggccattgtcctttccaccattgcttcagtaatgctgtttggattacagataacactcacctttgccctgggtactcttcttgtatgtgtttccatatatctctatggattacccagacaagacactacatccatccaacaaggagaaacagcttcaaaggagagagttattggtgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein tyrosine phosphatase, non-receptor type 18 (brain-derived) - potassium voltage-gated channel, shaker-related subfamily, member 6 - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 - asp (abnormal spindle) homolog, microcephaly associated (Drosophila) |