Cart 1 Product Products 115,24 € (empty)
No products
To be determined Shipping
115,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 115,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 115,24 €
View larger 
FUT6-fucosyltransferase 6 (alpha (1,3) fucosyltransferase) Gene
PTXBC061700
New product
Data sheet of FUT6-fucosyltransferase 6 (alpha (1,3) fucosyltransferase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FUT6-fucosyltransferase 6 (alpha (1,3) fucosyltransferase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC061700 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FUT6 |
| Origin species: | Human |
| Product name: | FUT6-fucosyltransferase 6 (alpha (1,3) fucosyltransferase) Gene |
| Size: | 2ug |
| Accessions: | BC061700 |
| Gene id: | 2528 |
| Gene description: | fucosyltransferase 6 (alpha (1,3) fucosyltransferase) |
| Synonyms: | FCT3A; FT1A; Fuc-TVI; FucT-VI; alpha-(1,3)-fucosyltransferase 6; fucosyltransferase 6 (alpha (1,3) fucosyltransferase); fucosyltransferase VI; galactoside 3-L-fucosyltransferase; fucosyltransferase 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatcccctgggcccggccaagccacagtggtcgtggcgctgctgtctgaccacgctgctgtttcacctgctgatggctgtgtgtttcttctcctatctgcgtgtgtctcaagacgatcccactgtgtaccctaatgggtcccgcttcccagacagcacagggacccccgcccactccatccccctgatcctgctgtggacgtggccttttaacaaacccatagctctgccccgctgctcagagatggtgcctggcacggctgactgcaacatcactgccgaccgcaaggtgtatccacaggcagacgcggtcatcgtgcaccaccgagaggtcatgtacaaccccagtgcccagctcccacgctcctcgaggcggcaggggcagcgatggatctggttcagcatggagtccccaagccactgctggcagctgaaagccatggacggatacttcaatctcaccatgtcctaccgcagcgactccgacatcttcacgccctacggctggctggagccgtggtccggccagcctgcccacccaccgctcaacctctcggccaagaccgagctggtggcctgggcagtgtccaactgggggccaaactccgccagggtgcgctactaccagagcctgcaggcccatctcaaggtggacgtgtacggacgctcccacaagcccctgccccagggaaccatgatggagacgctgtcccggtacaagttctatctggccttcaagaactccttgcaccccgactacatcaccgagaagctgtggaggaacgccctggaggcctgggccgtgcccgtggtgctgggccccagcagaagcaactacgagaggttcctgccgcccgacgccttcatccacgtggacgacttccagagccccaaggacctggcccggtacctgcaggagctggacaaggaccacgcccgctacctgagctactttcgctggcgggagacgctgcggcctcgctccttcagctgggcactcgctttctgcaaggcctgctggaaactgcaggaggaatccaggtaccagacacgcggcatagcggcttggttcacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - signal transducer and activator of transcription 5B - telomeric repeat binding factor (NIMA-interacting) 1 - LATS, large tumor suppressor, homolog 1 (Drosophila) - similar to mitochondrial carrier triple repeat 1 |