Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FCN1-ficolin (collagen/fibrinogen domain containing) 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FCN1-ficolin (collagen/fibrinogen domain containing) 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020635 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FCN1 |
| Origin species: | Human |
| Product name: | FCN1-ficolin (collagen/fibrinogen domain containing) 1 Gene |
| Size: | 2ug |
| Accessions: | BC020635 |
| Gene id: | 2219 |
| Gene description: | ficolin (collagen/fibrinogen domain containing) 1 |
| Synonyms: | FCNM; ficolin-1; M-ficolin; ficolin (collagen/fibrinogen domain-containing) 1; ficolin-A; ficolin-alpha; ficolin 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagctgagtggagccaccatggcccggggtctcgctgtcctgctagtcttgttcctgcatatcaagaacctgcctgcccaggctgcggacacatgtccagaggtgaaggtggtgggcctggagggctctgacaagctcaccattctccgaggctgcccggggctgcccggggccccagggccaaagggagaggcaggtgtcattggagagagaggagaacgcggtctccctggagcccctggaaaggcaggaccagtggggcccaaaggagaccgaggagagaaggggatgcgtggagagaaaggagacgctgggcagtctcagtcgtgtgcgacaggcccacgcaactgcaaggacctgctagaccgggggtatttcctgagcggctggcacaccatctacctgcccgactgccggcccctgactgtgctctgtgacatggacacggacggagggggctggaccgttttccagcggaggatggatggctctgtggacttctatcgggactgggccgcatacaagcagggcttcggcagtcagctgggggagttctggctggggaacgacaacatccacgccctgactgcccagggaagcagcgagctccgtgtagacctggtggactttgagggcaaccaccagtttgctaagtacaaatcattcaaggtggctgacgaggcagagaagtacaagctggtactgggagcctttgtcgggggcagtgcgggtaattctctaacgggccacaacaacaacttcttctccaccaaagaccaagacaatgatgtgagttcttcgaattgtgctgagaagttccagggagcctggtggtacgccgactgtcatgcttcaaacctcaatggtctctacctcatgggaccccatgagagctatgccaatggtatcaactggagtgcggcgaaggggtacaaatatagctacaaggtgtcagagatgaaggtgcggcccgcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - P antigen family, member 2 (prostate associated) - CD244 molecule, natural killer cell receptor 2B4 - phosphodiesterase 6H, cGMP-specific, cone, gamma - cystatin 8 (cystatin-related epididymal specific) |