Cart 9 Product Products 1 016,53 € (empty)
-
-
1 x TRIP13-thy...121,50 € -
1 x ELOVL2-elo...121,50 € -
1 x NXPH4-neur...121,50 € -
1 x BIK-BCL2-i...113,40 € -
1 x HPRT1-hypo...113,40 € -
-
-
1 x GRPEL2-Grp...113,40 €
No products
To be determined Shipping
1 016,53 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 016,53 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 016,53 €
View larger 
SLC22A9-solute carrier family 22 (organic anion transporter), member 9 Gene
PTXBC022379
New product
Data sheet of SLC22A9-solute carrier family 22 (organic anion transporter), member 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC22A9-solute carrier family 22 (organic anion transporter), member 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022379 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC22A9 |
| Origin species: | Human |
| Product name: | SLC22A9-solute carrier family 22 (organic anion transporter), member 9 Gene |
| Size: | 2ug |
| Accessions: | BC022379 |
| Gene id: | 114571 |
| Gene description: | solute carrier family 22 (organic anion transporter), member 9 |
| Synonyms: | HOAT4; OAT4; OAT7; UST3H; ust3; solute carrier family 22 member 9; organic anion transporter 4; organic anion transporter 7; solute carrier family 22 (organic anion transporter), member 9; solute carrier family 22 (organic anion/cation transporter), member 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctttcaggacctcctgggtcacgctggtgacctgtggagattccagatccttcagactgtttttctctcaatctttgctgttgctacataccttcattttatgctggagaacttcactgcattcatacctggccatcgctgctgggtccacatcctggacaatgacactgtctctgacaatgacactggggccctcagccaagatgcactcttgagaatctccatcccactggactcaaacatgaggccagagaagtgtcgtcgctttgttcatcctcagtggcagctccttcacctgaatgggaccttccccaacacaagtgacgcagacatggagccctgtgtggatggctgggtgtatgacagaatctccttctcatccaccatcgtgactgagtgggatctggtatgtgactctcaatcactgacttcagtggctaaatttgtattcatggctggaatgatggtgggaggcatcctaggcggtcatttatcagacagtagccgagtgggcaacacacagattccaggccatgggaattacattgggaatgtgcccttctggtattgcatttatgaccctggcaggcctggcttttgccattcgagactggcatatcctccagctggtggtgtctgtaccatactttgtgatctttctgacctcaagttggctgctagagtctgctcggtggctcattatcaacaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) - solute carrier family 22 (organic anion transporter), member 7 - RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae) - dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 |