Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MS4A8B-membrane-spanning 4-domains, subfamily A, member 8B Gene
PTXBC022895
New product
Data sheet of MS4A8B-membrane-spanning 4-domains, subfamily A, member 8B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MS4A8B-membrane-spanning 4-domains, subfamily A, member 8B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022895 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MS4A8B |
| Origin species: | Human |
| Product name: | MS4A8B-membrane-spanning 4-domains, subfamily A, member 8B Gene |
| Size: | 2ug |
| Accessions: | BC022895 |
| Gene id: | 83661 |
| Gene description: | membrane-spanning 4-domains, subfamily A, member 8B |
| Synonyms: | MS4A8B; 4SPAN4; CD20L5; MS4A4; membrane-spanning 4-domains subfamily A member 8; four-span transmembrane protein 4; membrane-spanning 4-domains, subfamily A, member 8B; membrane spanning 4-domains A8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaattcgatgacttcagcagttccggtggccaattctgtgttggtggtggcaccccacaatggttatcctgtgaccccaggaattatgtctcacgtgcccctgtatccaaacagccagccgcaagtccacctagttcctgggaacccacctagtttggtgtcgaatgtgaatgggcagcctgtgcagaaagctctgaaagaaggcaaaaccttgggggccatccagatcatcattggcctggctcgcatcggcctcggctccatcatggcgacggttctcgtaggggaatacctgtctatttcattctacggaggctttcccttctggggaggcttgtggtttatcatttcaggatctctctccgtggcagcagaaaatcagccatattcttattgcctgctgtctggcagtttgggcttgaacatcgtcagtgcaatctgctctgcagttggagtcatactcttcatcacagatctaagtattccccacccatatgcctaccccgactattatccttacgcctggggtgtgaaccctggaatggcgatttctggcgtgctgctggtcttctgcctcctggagtttggcatcgcatgcgcatcttcccactttggctgccagttggtctgctgtcaatcaagcaatgtgagtgtcatctatccaaacatctatgcagcaaacccagtgatcaccccagaaccggtgacctcaccaccaagttattccagtgagatccaagcaaataagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fucosyltransferase 6 (alpha (1,3) fucosyltransferase) - signal transducer and activator of transcription 5B - telomeric repeat binding factor (NIMA-interacting) 1 - LATS, large tumor suppressor, homolog 1 (Drosophila) |