Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TMED6-transmembrane emp24 protein transport domain containing 6 Gene
PTXBC020827
New product
Data sheet of TMED6-transmembrane emp24 protein transport domain containing 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMED6-transmembrane emp24 protein transport domain containing 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020827 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMED6 |
| Origin species: | Human |
| Product name: | TMED6-transmembrane emp24 protein transport domain containing 6 Gene |
| Size: | 2ug |
| Accessions: | BC020827 |
| Gene id: | 146456 |
| Gene description: | transmembrane emp24 protein transport domain containing 6 |
| Synonyms: | PRO34237; SPLL9146; p24g5; transmembrane emp24 domain-containing protein 6; p24 family protein gamma-5; p24gamma5; transmembrane emp24 protein transport domain containing 6; transmembrane p24 trafficking protein 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcccctttgctctttggggctgggctggtcgttctgaatctagtgacgtctgccaggagccagaagacagaacctctaagtggctctggggaccagccactcttccgtggagctgatcgatatgactttgccatcatgatacctccaggaggcacggaatgcttttggcaatttgcccaccagactggatacttctatttcagttgcgaggttcagcggacagtggggatgtcacatgaccggcatgttgctgccacggcacataacccacagggatttctcatagacacctcccagggtgttcggggccagattaacttctctacccaagagacaggtttttatcagctttgtctaagtaatcagcataatcacttcggttctgtgcaagtgtacctcaactttggggtcttctatgaggggcctgagactgatcacaaacagaaggaaagaaaacaactgaatgatactctggatgcaattgaggacggcacacaaaaggtgcagaacaatatctttcacatgtggcgatactacaactttgcccggatgaggaaaatggctgactttttccttatccaatcaaactataactacgtgaactggtggtcgacagcccagagccttgttattattctttctgggatcctgcaactgtatttcttgaagcgtctcttcaatgttccaacaactacagatacaaagaagccaagatgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor necrosis factor (ligand) superfamily, member 13b - zinc finger and BTB domain containing 8 opposite strand - solute carrier family 39 (zinc transporter), member 13 - nicotinate phosphoribosyltransferase domain containing 1 |