Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PDLIM5-PDZ and LIM domain 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PDLIM5-PDZ and LIM domain 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017902 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PDLIM5 |
| Origin species: | Human |
| Product name: | PDLIM5-PDZ and LIM domain 5 Gene |
| Size: | 2ug |
| Accessions: | BC017902 |
| Gene id: | 10611 |
| Gene description: | PDZ and LIM domain 5 |
| Synonyms: | ENH; ENH1; LIM; PDZ and LIM domain protein 5; enigma homolog; enigma-like LIM domain protein; enigma-like PDZ and LIM domains protein; PDZ and LIM domain 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcaactacagtgtgtcactggttggcccagctccttggggtttccggctgcagggcggtaaggatttcaacatgcctctgacaatctctagtctaaaagatggcggcaaggcagcccaggcaaatgtaagaataggcgatgtggttctcagcattgatggaataaatgcacaaggaatgactcatcttgaagcccagaataagattaagggttgtacaggctctttgaatatgactctgcaaagagcatctgctgcacccaagcctgagccggttcctgttcaaaagaaaacacaagtgacaaataaccctggcactgtgaaaatcccacctaaacgcccaccaagaaaacacattgtggagcgctatacagagttttatcatgtacccactcacagtgatgccagcaagaagagactgattgaggatactgaagactggcgtccaaggactggaacaactcaatctcgctctttccgaatccttgcccagatcactgggactgaacatttgaaagaatctgaagccgataatacaaagaaggcaaaggaaaagataccccttcacgtctttagtcccaaatacacaaaattacgtgactggcaccatgaagtttcagcacgtgctcttaacgtacagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - iodotyrosine deiodinase - succinate receptor 1 - peptidase inhibitor 16 - angiopoietin-like 3 |