Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CCDC5-coiled-coil domain containing 5 (spindle associated) Gene
PTXBC005958
New product
Data sheet of CCDC5-coiled-coil domain containing 5 (spindle associated) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCDC5-coiled-coil domain containing 5 (spindle associated) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005958 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCDC5 |
| Origin species: | Human |
| Product name: | CCDC5-coiled-coil domain containing 5 (spindle associated) Gene |
| Size: | 2ug |
| Accessions: | BC005958 |
| Gene id: | 115106 |
| Gene description: | coiled-coil domain containing 5 (spindle associated) |
| Synonyms: | CCDC5; HEI-C; HEIC; HsT1461; HAUS augmin-like complex subunit 1; coiled-coil domain containing 5 (spindle associated); coiled-coil domain-containing protein 5; enhancer of invasion-cluster; HAUS augmin like complex subunit 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagagtgtgaatttttcccccgccaatctctctagcactggttccaggtatctgaatgctttggttgacagtgcggtggcccttgaaacaaaggatacctcgctagctagttttatccctgcagtgaatgatttgacctctgatctctttcgtaccaaatccaaaagtgaagaaatcaagattgaactggaaaaacttgaaaaaaatttaactgcaactttagtattagaaaaatgtctacaagaggatgtcaagaaagcagagttgcatctgtctacagaaagggccaaagttgataatcgtcgtcagaacatggactttctaaaagcaaagtcagaggaattcagatttggaatcaaggctgcagaggagcaactttcagccagaggcatggatgcttctctgtctcatcagtccttagtagcactatcagagaaactggcaagattaaagcaacagactatacctttgaagaaaaaattggagtcctatttagacttaatgccgaatccgtctcttgctcaagtgaaaattgaagaagcaaagcgagaactagatagcattgaagctgaacttacaagaagagtagacatgatggaactgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - membrane-spanning 4-domains, subfamily A, member 8B - fucosyltransferase 6 (alpha (1,3) fucosyltransferase) - signal transducer and activator of transcription 5B - telomeric repeat binding factor (NIMA-interacting) 1 |