Cart 5 Product Products 587,37 € (empty)
-
1 x SUCLG2-suc...121,50 € -
1 x CUEDC2-CUE...113,40 € -
1 x AVL9-AVL9...121,50 € -
1 x CCDC51-coi...121,50 € -
No products
To be determined Shipping
587,37 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 587,37 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 587,37 €
Data sheet of MYF6-myogenic factor 6 (herculin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MYF6-myogenic factor 6 (herculin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017834 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MYF6 |
| Origin species: | Human |
| Product name: | MYF6-myogenic factor 6 (herculin) Gene |
| Size: | 2ug |
| Accessions: | BC017834 |
| Gene id: | 4618 |
| Gene description: | myogenic factor 6 (herculin) |
| Synonyms: | CNM3; MRF4; bHLHc4; myf-6; myogenic factor 6; class C basic helix-loop-helix protein 4; muscle-specific regulatory factor 4; myogenic factor 6 (herculin) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgatggacctttttgaaactggctcctatttcttctacttggatggggaaaatgttactctgcagccattagaagtggcagaaggctctcctttgtatccagggagtgatggtaccttgtccccctgccaggaccaaatgcccccggaagcggggagcgacagcagcggagaggaacatgtcctggcgcccccgggcctgcagcctccacactgccccggccagtgtctgatctgggcttgcaagacctgcaagagaaaatctgcccccactgaccggcgaaaagccgccaccctgcgcgaaaggaggaggctaaagaaaatcaacgaggccttcgaggcactgaagcggcgaactgtggccaaccccaaccagaggctgcccaaggtggagattctgcggagcgccatcagctatattgagcggctgcaggacctgctgcaccggctggatcagcaggagaagatgcaggagctgggggtggaccccttcagctacagacccaaacaagaaaatcttgagggtgcggatttcctgcgcacctgcagctcccagtggccaagtgtttccgatcattccagggggctcgtgataacggctaaggaaggaggagcaagtattgattcgtcagcctcgagtagccttcgatgcctttcttccatcgtggacagtatttcctcggaggaacgcaaactcccctgcgtggaggaagtggtggagaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 116 - helicase, lymphoid-specific - transmembrane protein 156 - popeye domain containing 3 |