PTXBC017769
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC017769 |
Product type: | DNA & cDNA |
Ncbi symbol: | LRRTM4 |
Origin species: | Human |
Product name: | LRRTM4-leucine rich repeat transmembrane neuronal 4 Gene |
Size: | 2ug |
Accessions: | BC017769 |
Gene id: | 80059 |
Gene description: | leucine rich repeat transmembrane neuronal 4 |
Synonyms: | leucine-rich repeat transmembrane neuronal protein 4; leucine rich repeat transmembrane neuronal 4 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgtgggaatgcagtcggagcatttgtcctttattttattggcttaagaatttcaaaggaaataaggaaagcaccatgatatgtgcgggacctaagcacatccagggtgaaaaggttagtgatgcagtggaaacatataatatctgttctgaagtccaggtggtcaacacagaaagatcacacctggtgccccaaactccccagaaacctctgattatccctagacctaccatcttcaaacctgacgtcacccaatccacctttgaaacaccaagcccttccccagggtttcagattcctggcgcagagcaagagtatgagcatgtttcatttcacaaaattattgccgggagtgtggctctctttctctcagtggccatgatcctcttggtgatctatgtgtcttggaaacgctacccagccagcatgaaacaactccagcaacactctcttatgaagaggcggcggaaaaaggccagagagtctgaaagacaaatgaattcccctttacaggagtattatgtggactacaagcctacaaactctgagaccatggatatatcggttaatggatctgggccctgcacatataccatctctggctccagggaatgtgaggtatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - EMG1 nucleolar protein homolog (S. cerevisiae) - progestin and adipoQ receptor family member V - family with sequence similarity 45, member A - family with sequence similarity 89, member B |