Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of IL1F7-interleukin 1 family, member 7 (zeta) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL1F7-interleukin 1 family, member 7 (zeta) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020637 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL1F7 |
| Origin species: | Human |
| Product name: | IL1F7-interleukin 1 family, member 7 (zeta) Gene |
| Size: | 2ug |
| Accessions: | BC020637 |
| Gene id: | 27178 |
| Gene description: | interleukin 1 family, member 7 (zeta) |
| Synonyms: | IL1F7 (canonical product IL-1F7b); IL1F7; FIL1; FIL1(ZETA); FIL1Z; IL-1F7; IL-1H; IL-1H4; IL-1RP1; IL-37; IL1H4; IL1RP1; interleukin-37; FIL1 zeta; IL-1 zeta; IL-1F7b (IL-1H4, IL-1H, IL-1RP1); IL-1X protein; interleukin 1 family member 7; interleukin 1, zeta; interleukin-1 homolog 4; interleukin-1 superfamily z; interleukin-1-related protein; interleukin-23; interleukin 37 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcctttgtgggggagaactcaggagtgaaaatgggctctgaggactgggaaaaagatgaaccccagtgctgcttagaagacccggctgtaagccccctggaaccaggcccaagcctccccgccatgaattttgttcacacaagtccaaaggtgaagaacttaaacccgaagaaattcagcattcatgaccaggatcacaaagtactggtcctggactctgggaatctcatagcagttccagataaaaactacatacgcccagagatcttctttgcattagcctcatccttgagctcagcctctgcggagaaaggaagtccgattctcctgggggtctctaaaggggagttttgtctctactgtgacaaggataaaggacaaagtcatccatcccttcagctgaagaaggagaaactgatgaagctggctgcccaaaaggaatcagcacgccggcccttcatcttttatagggctcaggtgggctcctggaacatgctggagtcggcggctcaccccggatggttcatctgcacctcctgcaattgtaatgagcctgttggggtgacagataaatttgagaacaggaaacacattgaattttcatttcaaccagtttgcaaagctgaaatgagccccagtgaggtcagcgattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - basic leucine zipper nuclear factor 1 - ribosomal protein L23a pseudogene - NOL1/NOP2/Sun domain family, member 3 - carbohydrate kinase domain containing |