> >>ORM1-orosomucoid 1 Gene
ORM1-orosomucoid 1 Gene View larger

ORM1-orosomucoid 1 Gene

PTXBC026238

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of ORM1-orosomucoid 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ORM1-orosomucoid 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026238
Product type: DNA & cDNA
Ncbi symbol: ORM1
Origin species: Human
Product name: ORM1-orosomucoid 1 Gene
Size: 2ug
Accessions: BC026238
Gene id: 5004
Gene description: orosomucoid 1
Synonyms: AGP-A; AGP1; HEL-S-153w; ORM; alpha-1-acid glycoprotein 1; AGP 1; OMD 1; epididymis secretory sperm binding protein Li 153w; orosomucoid 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctgtcctgggttcttacagtcctgagcctcctacctctgctggaagcccagatcccattgtgtgccaacctagtaccggtgcccatcaccaacgccaccctggaccggatcactggcaagtggttttatatcgcatcggcctttcgaaacgaggagtacaataagtcggttcaggagatccaagcaaccttcttttacttcacccccaacaagacagaggacacgatctttctcagagagtaccagacccgacaggaccagtgcatctataacaccacctacctgaatgtccagcgggaaaatgggaccatctccagatacgtgggaggccaagagcatttcgctcacttgctgatcctcagggacaccaagacctacatgcttgcttttgacgtgaacgatgagaagaactgggggctgtctgtctatgctgacaagccagagacgaccaaggagcaactgggagagttctacgaagctctcgactgcttgcgcattcccaagtcagatgtcgtgtacaccgattggaaaaaggataagtgtgagccactggagaagcagcacgagaaggagaggaaacaggaggagggggaatcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD96 molecule
- ubiquilin 1
- aquaporin 10
- MAS1 oncogene

Reviews

Buy ORM1-orosomucoid 1 Gene now

Add to cart