Cart 32 Product Products 4 096,50 € (empty)
-
1 x C10orf81-c...121,50 € -
1 x TXNDC9-thi...113,40 € -
1 x C5orf4-chr...121,50 € -
1 x C10orf78-c...113,40 € -
1 x C1orf94-ch...121,50 € -
1 x SNX10-sort...113,40 € -
1 x ZSCAN2-zin...113,40 € -
1 x PSMA1-prot...113,40 € -
1 x LRRIQ3-leu...113,40 € -
1 x CPLX1-comp...113,40 € -
1 x SAP30L-SAP...113,40 € -
1 x CTNNBIP1-c...113,40 € -
1 x SSX3-synov...113,40 € -
-
1 x LCE2D-late...113,40 € -
1 x C9orf68-ch...113,40 € -
1 x MRGPRX2-MA...121,50 € -
1 x NPL-N-acet...113,40 € -
1 x RBM4B-RNA...121,50 € -
1 x C16orf52-c...113,40 € -
1 x NSL1-NSL1,...121,50 € -
1 x DRD2-dopam...121,50 € -
1 x CTF1-cardi...113,40 € -
-
1 x CLK2-CDC-l...121,50 € -
-
-
-
1 x COX6A2-cyt...113,40 € -
1 x TMTC4-tran...121,50 € -
1 x C19orf43-c...113,40 € -
1 x GSDMD-gasd...121,50 €
No products
To be determined Shipping
4 096,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 32 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 096,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 096,50 €
Data sheet of MRPL30-mitochondrial ribosomal protein L30 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL30-mitochondrial ribosomal protein L30 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022391 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL30 |
| Origin species: | Human |
| Product name: | MRPL30-mitochondrial ribosomal protein L30 Gene |
| Size: | 2ug |
| Accessions: | BC022391 |
| Gene id: | 51263 |
| Gene description: | mitochondrial ribosomal protein L30 |
| Synonyms: | L28MT; L30MT; MRP-L28; MRP-L30; MRPL28; MRPL28M; RPML28; 39S ribosomal protein L30, mitochondrial; 39S ribosomal protein L28, mitochondrial; mitochondrial ribosomal protein L30 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgggattttgcgcttagtagttcaatggcccccaggcagactacagaccgtgacaaaaggtgtggagtctcttatttgtacagattggattcgtcacaaattcaccagatcaagaattccagaaaaagtgtttcaggcctcacctgaagatcatgaaaaatacggtggggatccacagaaccctcataaactgcatattgttaccagaataaaaagtacaagaagacgtccatattgggaaaaagatataataaagatgcttggattagaaaaagcacatacccctcaagttcacaagaatatcccttcagtgaatgcaaaattgaaagtagttaagcatttgataagaatcaagcccttgaagttgccacaaggacttccagcagaggagaacatgtctaacacgtgcctcaaaagcactggggagttagtagtgcagtggcatctgaaacctgtggagcagaaagcacatgagtcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial ribosomal protein L35 - chromosome 3 open reading frame 14 - chromosome 2 open reading frame 34 - immunoglobulin superfamily, member 6 |