> >>RBBP6-retinoblastoma binding protein 6 Gene
RBBP6-retinoblastoma binding protein 6 Gene View larger

RBBP6-retinoblastoma binding protein 6 Gene

PTXBC029352

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of RBBP6-retinoblastoma binding protein 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RBBP6-retinoblastoma binding protein 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029352
Product type: DNA & cDNA
Ncbi symbol: RBBP6
Origin species: Human
Product name: RBBP6-retinoblastoma binding protein 6 Gene
Size: 2ug
Accessions: BC029352
Gene id: 5930
Gene description: retinoblastoma binding protein 6
Synonyms: E3 ubiquitin-protein ligase RBBP6; MY038; P2P-R; PACT; RBQ-1; SNAMA; RB-binding Q-protein 1; p53-associated cellular protein of testis; proliferation potential-related protein; protein P2P-R; retinoblastoma binding protein 6; retinoblastoma-binding Q protein 1; retinoblastoma-binding protein 6; RB binding protein 6, ubiquitin ligase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctgtgtgcattataaattttcctctaaactcaactatgataccgtcacctttgatgggctccacatctccctctgcgacttaaagaagcagattatggggagagagaagctgaaagctgccgactgcgacctgcagatcaccaatgcgcagacgaaagaagaatatactgatgataatgctctgattcctaagaattcttctgtaattgttagaagaattcctattggaggtgttaaatctacaagcaagacatatgttataagtcgaactgaaccagcgatggcaactacaaaagcagtatgtaaaaacacaatctcacactttttctacacattgcttttacctttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chloride intracellular channel 2
- chloride intracellular channel 5
- retinol binding protein 4, plasma
- occludin/ELL domain containing 1

Reviews

Buy RBBP6-retinoblastoma binding protein 6 Gene now

Add to cart