Cart 1 Product Products 534,00 € (empty)
-
1 x Syndecan-1...534,00 €
No products
To be determined Shipping
534,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 534,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 534,00 €
View larger 
CHAC2-ChaC, cation transport regulator homolog 2 (E. coli) Gene
PTXBC017941
New product
Data sheet of CHAC2-ChaC, cation transport regulator homolog 2 (E. coli) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHAC2-ChaC, cation transport regulator homolog 2 (E. coli) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017941 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHAC2 |
| Origin species: | Human |
| Product name: | CHAC2-ChaC, cation transport regulator homolog 2 (E. coli) Gene |
| Size: | 2ug |
| Accessions: | BC017941 |
| Gene id: | 494143 |
| Gene description: | ChaC, cation transport regulator homolog 2 (E. coli) |
| Synonyms: | ChaC, cation transport regulator-like 2; cation transport regulator-like protein 2; gamma-GCG 2; gamma-GCT acting on glutathione homolog 2; ChaC cation transport regulator homolog 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgggtttttggttacgggtccctgatctggaaggtggatttcccctatcaggacaagctggtcggatacatcaccaactacagcaggcgcttctggcagggcagcacggaccaccgcggggtccccggcaagcctggaagagttgtgactcttgttgaagatcctgcgggatgtgtatggggtgttgcttacagattgccagtaggaaaggaagaagaagtaaaagcataccttgacttcggagaaaaaggaggctacagaaccacaacagtcattttttatccaaaagatcccacaacaaaaccattcagtgtattgctatatattggaacatgtgataatcctgattatcttggtcctgcacctctggaagacattgctgaacaaatttttaatgcagctggtccaagtggaagaaatacagaatatctttttgaacttgcaaattctattaggaaccttgtgccagaagaagcagatgagcatcttttcgctttggaaaaattagtaaaggaacgtttagaagggaaacagaacctcaattgcatataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dynein, cytoplasmic 2, light intermediate chain 1 - coiled-coil domain containing 5 (spindle associated) - membrane-spanning 4-domains, subfamily A, member 8B - fucosyltransferase 6 (alpha (1,3) fucosyltransferase) |