> >>SLC16A10-solute carrier family 16, member 10 (aromatic amino acid transporter) Gene
SLC16A10-solute carrier family 16, member 10 (aromatic amino acid transporter) Gene View larger

SLC16A10-solute carrier family 16, member 10 (aromatic amino acid transporter) Gene

PTXBC017968

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of SLC16A10-solute carrier family 16, member 10 (aromatic amino acid transporter) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC16A10-solute carrier family 16, member 10 (aromatic amino acid transporter) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017968
Product type: DNA & cDNA
Ncbi symbol: SLC16A10
Origin species: Human
Product name: SLC16A10-solute carrier family 16, member 10 (aromatic amino acid transporter) Gene
Size: 2ug
Accessions: BC017968
Gene id: 117247
Gene description: solute carrier family 16, member 10 (aromatic amino acid transporter)
Synonyms: MCT10; PRO0813; TAT1; monocarboxylate transporter 10; MCT 10; T-type amino acid transporter 1; aromatic amino acid transporter 1; solute carrier family 16 (aromatic amino acid transporter), member 10; solute carrier family 16 (monocarboxylic acid transporters), member 10; solute carrier family 16, member 10 (aromatic amino acid transporter); solute carrier family 16 member 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaacatgtaaatgaaagatttcaagatgaaaaaaataaagaggttgttctcatgtgcattggcgtcacttcaggagttggacgactgctctttggccggattgcagattatgtgcctggtgtgaagaaggtttatctacaggtactctcctttttcttcattggtctgatgtccatgatgattcctctgtgtagcatctttggggccctcattgctgtgtgcctcatcatgggtctcttcgatggatgcttcatttccattatggctcccatagcctttgagttagttggtgcccaggatgtctcccaagcaattggacttctgctcggattcatgtctatacccatgactgttggcccacccattgcagggttacttcgtgacaaactgggctcctatgatgtggcattctacctcgctggagtccctccccttattggaggtgctgtgctttgttttatcccgtggatccatagtaagaagcaaagagagatcagtaaaaccactggaaaagaaaagatggagaaaatgttggaaaaccagaactctctgctgtcaagttcatctggaatgttcgagaaagaatctgactctattatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - growth arrest and DNA-damage-inducible, gamma interacting protein 1
- solute carrier family 16, member 6 (monocarboxylic acid transporter 7)
- solute carrier family 16, member 5 (monocarboxylic acid transporter 6)
- optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia)

Reviews

Buy SLC16A10-solute carrier family 16, member 10 (aromatic amino acid transporter) Gene now

Add to cart