TMEM135-transmembrane protein 135 Gene View larger

TMEM135-transmembrane protein 135 Gene

PTXBC030952

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM135-transmembrane protein 135 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM135-transmembrane protein 135 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030952
Product type: DNA & cDNA
Ncbi symbol: TMEM135
Origin species: Human
Product name: TMEM135-transmembrane protein 135 Gene
Size: 2ug
Accessions: BC030952
Gene id: 65084
Gene description: transmembrane protein 135
Synonyms: PMP52; transmembrane protein 135; peroxisomal membrane protein 52
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccctcagcaagtccatccctcataactgctatgagatcggccacacttggcacccttcctgccgggtctccttcctgcagatcaccgggggcgccctggaggagtccctgaagatctatgctcctctgtacttgattgcagcaattctccggaaacggaaattagactattatttacacaaactactccctgagatcctacaatccgcttcatttctaactgctaatggggccttgtatatggctttcttttgcattttaaggaagatacttggaaaattctactcatggactcctggctttggtgccgctctgccagcatcttatgtggccattctcattgaaagaaaaagcaggagagggctgctcacaatttatatggccaacttgatggagtctcactgtcttccccaggctggagtgatttcagctccctgcagcctctgcctcccaggttcaagggattctcctgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - M-phase phosphoprotein 6
- myogenic factor 6 (herculin)
- transmembrane protein 116
- helicase, lymphoid-specific

Reviews

Buy TMEM135-transmembrane protein 135 Gene now

Add to cart