Cart 29 Product Products 3 381,62 € (empty)
-
1 x CMKLR1-che...121,50 € -
1 x HMGB2-high...113,40 € -
1 x CDKN2C-cyc...113,40 € -
1 x PUS7-pseud...113,40 € -
1 x RBM26-RNA...113,40 € -
1 x RNMTL1-RNA...121,50 € -
1 x MTHFD2L-me...113,40 € -
1 x ATP5S-ATP...113,40 € -
1 x GTF2H3-gen...121,50 € -
1 x FAM105B-fa...121,50 € -
1 x C1orf182-c...113,40 € -
1 x ADAMDEC1-A...121,50 € -
1 x GABPB1-GA...121,50 € -
1 x NPPA-natri...113,40 € -
1 x KCTD6-pota...113,40 € -
1 x CADM1-cell...121,50 € -
1 x FAM102B-fa...121,50 € -
1 x C19orf57-c...121,50 € -
1 x TEAD2-TEA...121,50 € -
-
1 x GABPB1-GA...121,50 € -
1 x PROC-prote...121,50 € -
1 x C1orf105-c...113,40 € -
1 x C1orf2-chr...113,40 € -
1 x SC65-synap...121,50 € -
1 x C4orf33-ch...113,40 € -
1 x PTH1R-para...121,50 € -
1 x DTWD1-DTW...113,40 € -
1 x CD79B-CD79...113,40 €
No products
To be determined Shipping
3 381,62 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 29 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 381,62 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 381,62 €
View larger 
VAMP5-vesicle-associated membrane protein 5 (myobrevin) Gene
PTXBC017891
New product
Data sheet of VAMP5-vesicle-associated membrane protein 5 (myobrevin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VAMP5-vesicle-associated membrane protein 5 (myobrevin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017891 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VAMP5 |
| Origin species: | Human |
| Product name: | VAMP5-vesicle-associated membrane protein 5 (myobrevin) Gene |
| Size: | 2ug |
| Accessions: | BC017891 |
| Gene id: | 10791 |
| Gene description: | vesicle-associated membrane protein 5 (myobrevin) |
| Synonyms: | vesicle-associated membrane protein 5; VAMP-5; myobrevin; vesicle associated membrane protein 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaggaatagagttggagcggtgccagcagcaggcgaacgaggtgacggaaattatgcgtaacaacttcggcaaggtcctggagcgtggtgtgaagctggccgaactgcagcagcgttcagaccaactcctggatatgagctcaaccttcaacaagactacacagaacctggcccagaagaagtgctgggagaacatccgttaccggatctgcgtggggctggtggtggttggtgtcctgctcatcatcctgattgtgctgctggtcgtctttctccctcagagcagtgacagcagtagtgccccacggacccaggatgcaggcattgcctcagggcctgggaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - radical S-adenosyl methionine domain containing 2 - alcohol dehydrogenase 4 (class II), pi polypeptide - RNA pseudouridylate synthase domain containing 3 - upstream transcription factor 2, c-fos interacting |