ZMYM6-zinc finger, MYM-type 6 Gene View larger

ZMYM6-zinc finger, MYM-type 6 Gene

PTXBC029439

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZMYM6-zinc finger, MYM-type 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZMYM6-zinc finger, MYM-type 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029439
Product type: DNA & cDNA
Ncbi symbol: ZMYM6
Origin species: Human
Product name: ZMYM6-zinc finger, MYM-type 6 Gene
Size: 2ug
Accessions: BC029439
Gene id: 9204
Gene description: zinc finger, MYM-type 6
Synonyms: Buster2; MYM; ZBED7; ZNF198L4; ZNF258; zinc finger MYM-type protein 6; transposon-derived Buster2 transposase-like protein; zinc finger protein 258; zinc finger, BED-type containing 7; zinc finger, MYM-type 6; zinc finger MYM-type containing 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctcctgctttcggtgctgcgtgtactgctgggcggcttcttcgcgctcgtggggttggccaagctctcggaggagatctcggctccagtttcggagcggatgaatgccctgttcgtgcagtttgctgaggtgttcccgctgaaggtatttggctaccagccagatcccctgaactaccaaatagctgtgggctttctggaactgctggctgggttgctgctggtcatgggcccaccgatgctgcaagagatcagtaacttgttcttgattctgctcatgatgggggctatcttcaccttggcagctctgaaagagtcactaagcacctgtatcccagccattgtctgcctggggttcctgctgctgctgaatgtcggccagctcttagcccagactaagaaggtggtcagacccactaggaagaagactctaagtacattcaaggaatcctggaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Impact homolog (mouse)
- starch binding domain 1
- tropomodulin 4 (muscle)
- ADP-ribosyltransferase 3

Reviews

Buy ZMYM6-zinc finger, MYM-type 6 Gene now

Add to cart