Cart 2 Product Products 340,50 € (empty)
-
1 x Goat...219,00 € -
1 x ZNF774-zin...121,50 €
No products
To be determined Shipping
340,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 340,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 340,50 €
View larger 
CYP19A1-cytochrome P450, family 19, subfamily A, polypeptide 1 Gene
PTXBC022896
New product
Data sheet of CYP19A1-cytochrome P450, family 19, subfamily A, polypeptide 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CYP19A1-cytochrome P450, family 19, subfamily A, polypeptide 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022896 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CYP19A1 |
| Origin species: | Human |
| Product name: | CYP19A1-cytochrome P450, family 19, subfamily A, polypeptide 1 Gene |
| Size: | 2ug |
| Accessions: | BC022896 |
| Gene id: | 1588 |
| Gene description: | cytochrome P450, family 19, subfamily A, polypeptide 1 |
| Synonyms: | ARO; ARO1; CPV1; CYAR; CYP19; CYPXIX; P-450AROM; cytochrome P-450AROM; cytochrome P450 19A1; cytochrome P450, family 19, subfamily A, polypeptide 1; cytochrome P450, subfamily XIX (aromatization of androgens); estrogen synthase; estrogen synthetase; flavoprotein-linked monooxygenase; microsomal monooxygenase; cytochrome P450 family 19 subfamily A member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttttggaaatgctgaacccgatacattataacatcaccagcatcgtgcctgaagccatgcctgctgccaccatgccagtcctgctcctcactggcctttttctcttggtgtggaattatgagggcacatcctcaataccaggtcctggctactgcatgggaattggacccctcatctcccacggcagattcctgtggatggggatcggcagtgcctgcaactactacaaccgggtgtatggagaattcatgcgagtctggatctctggagaggaaacactcattatcagcaagtcctcaagtatgttccacataatgaagcacaatcattacagctctcgattcggcagcaaacttgggctgcagtgcatcggtatgcatgagaaaggcatcatatttaacaacaatccagagctctggaaaacaactcgacccttctttatgaaagctctgtcaggccccggccttgttcgtatggtcacagtctgtgctgaatccctcaaaacacatctgctcctgttcacacctgctagtgtgaattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D - Fc fragment of IgG, low affinity IIIa, receptor (CD16a) - major histocompatibility complex, class II, DR beta 1 - oxidized low density lipoprotein (lectin-like) receptor 1 |