Cart 1 Product Products 121,50 € (empty)
-
1 x IMPACT-Imp...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
Data sheet of TMEM182-transmembrane protein 182 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM182-transmembrane protein 182 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020898 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM182 |
| Origin species: | Human |
| Product name: | TMEM182-transmembrane protein 182 Gene |
| Size: | 2ug |
| Accessions: | BC020898 |
| Gene id: | 130827 |
| Gene description: | transmembrane protein 182 |
| Synonyms: | transmembrane protein 182 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctcctgggggtagttgctgtagtcatcgcaagctttttgatcatctgtgcagcccccttcgccagccattttctctacaaagctgggggaggctcatatattgctgcaggcatcctattttcattggtggtgatgctgtatgtcatctgggtccaggcagtggctgacatggaaagctaccgaaacatgaaaatgaaggactgcctggatttcaccccttctgttctgtatggctggtcatttttcctggccccagctgggatatttttttctttgctagctggattactatttctggttgttggacggcatattcagatacatcactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 135 - M-phase phosphoprotein 6 - myogenic factor 6 (herculin) - transmembrane protein 116 |