Cart 1 Product Products 115,24 € (empty)
No products
To be determined Shipping
115,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 115,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 115,24 €
View larger 
Data sheet of AGR3-anterior gradient homolog 3 (Xenopus laevis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AGR3-anterior gradient homolog 3 (Xenopus laevis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC058284 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AGR3 |
| Origin species: | Human |
| Product name: | AGR3-anterior gradient homolog 3 (Xenopus laevis) Gene |
| Size: | 2ug |
| Accessions: | BC058284 |
| Gene id: | 155465 |
| Gene description: | anterior gradient homolog 3 (Xenopus laevis) |
| Synonyms: | AG-3; AG3; BCMP11; HAG3; PDIA18; hAG-3; anterior gradient protein 3; anterior gradient homolog 3; anterior gradient protein 3 homolog; breast cancer membrane protein 11; protein disulfide isomerase family A, member 18; anterior gradient 3, protein disulphide isomerase family member |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgctacactcagctttgggtctctgcctcttactcgtcacagtttcttccaaccttgccattgcaataaaaaaggaaaagaggcctcctcagacactctcaagaggatggggagatgacatcacttgggtacaaacttatgaagaaggtctcttttatgctcaaaaaagtaagaagccattaatggttattcatcacctggaggattgtcaatactctcaagcactaaagaaagtatttgcccaaaatgaagaaatacaagaaatggctcagaataagttcatcatgctaaaccttatgcatgaaaccactgataagaatttatcacctgatgggcaatatgtgcctagaatcatgtttgtagacccttctttaacagttagagctgacatagctggaagatactctaacagattgtacacatatgagcctcgggatttacccctattgatagaaaacatgaagaaagcattaagacttattcagtcagagctataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sushi-repeat-containing protein, X-linked 2 - melanocortin 2 receptor accessory protein 2 - insulin-like growth factor 2 (somatomedin A) - heat shock transcription factor, Y-linked 1 |