TMEM68-transmembrane protein 68 Gene

View larger

TMEM68-transmembrane protein 68 Gene

Reference: PTXBC020835

Condition: New product

Print

Data sheet of TMEM68-transmembrane protein 68 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about TMEM68-transmembrane protein 68 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC020835
Product type:	DNA & cDNA
Ncbi symbol:	TMEM68
Origin species:	Human
Product name:	TMEM68-transmembrane protein 68 Gene
Size:	2ug
Accessions:	BC020835
Gene id:	137695
Gene description:	transmembrane protein 68
Synonyms:	transmembrane protein 68
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgatagacaaaaatcaaacctgtggtgtaggacaggattctgtgccctatatgatttgtctgattcacatactcgaagaatggtttggtgtggagcagttggaggactatttgaattttgcaaactatctcttgtgggtttttacaccactaatacttttaatacttccttactttactatctttcttctctaccttactattattttcttacacatttataagagaaagaatgtattgaaagaagcctactctcataatttatgggatggtgcaaggaaaacagtggcaactctgtgggatggacatgcagccgtttggcatggtaagcaaggatactttcacctttgtgttgccattcatgtgtgctgcattggaactgtgttaccattccattttattgattga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- MAPK scaffold protein 1 - SH2 domain containing 1B - insulin-like 4 (placenta) - SPRY domain containing 4

Reviews

Be the first to write your review !

Buy TMEM68-transmembrane protein 68 Gene now