PTMA-prothymosin, alpha Gene View larger

PTMA-prothymosin, alpha Gene

PTXBC022433

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTMA-prothymosin, alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PTMA-prothymosin, alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022433
Product type: DNA & cDNA
Ncbi symbol: PTMA
Origin species: Human
Product name: PTMA-prothymosin, alpha Gene
Size: 2ug
Accessions: BC022433
Gene id: 5757
Gene description: prothymosin, alpha
Synonyms: TMSA; gene sequence 28; prothymosin alpha protein; prothymosin, alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaaggtggggaggaagaggaggaggaagaagaaggtgatggtgaggaggagggtggagatgaagatgaggaagctgagtcagctacgggcaagcgggcagctgaagatgatgaggatgacgatgtcgataccaagaagcagaagaccgacgaggatgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WD repeat domain 3
- nuclear factor I/A
- complement factor I
- F-box protein 25

Reviews

Buy PTMA-prothymosin, alpha Gene now

Add to cart