> >>MGC24125-hypothetical protein MGC24125 Gene
MGC24125-hypothetical protein MGC24125 Gene View larger

MGC24125-hypothetical protein MGC24125 Gene

PTXBC020886

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of MGC24125-hypothetical protein MGC24125 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC24125-hypothetical protein MGC24125 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020886
Product type: DNA & cDNA
Ncbi symbol: MGC24125
Origin species: Human
Product name: MGC24125-hypothetical protein MGC24125 Gene
Size: 2ug
Accessions: BC020886
Gene id: 439935
Gene description: hypothetical protein MGC24125
Synonyms: uncharacterized LOC728175
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagaagaaagaagacgccacagacagcagcgcagtaccaccttccagagatgtgagtgtgaccgtctttgaccttctagcccagctgctttccctgaatgcaatgcatgagcaggccaggcaaaactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hemochromatosis type 2 (juvenile)
- retinoblastoma binding protein 6
- chloride intracellular channel 2
- chloride intracellular channel 5

Reviews

Buy MGC24125-hypothetical protein MGC24125 Gene now

Add to cart