Cart 10 Product Products 14 963,11 € (empty)
-
1 x PRPF38B-PR...113,40 € -
1 x VCY-variab...113,40 € -
1 x FAM154A-fa...121,50 € -
-
1 x JUNB-jun B...121,50 € -
1 x HLA-DRB1-m...121,50 € -
1 x VPS37A-vac...113,40 € -
-
1 x ASB8-ankyr...121,50 € -
1 x C2CD2-C2...121,50 €
No products
To be determined Shipping
14 963,11 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 14 963,11 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 14 963,11 €
Data sheet of AVL9-AVL9 homolog (S. cerevisiase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AVL9-AVL9 homolog (S. cerevisiase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027724 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AVL9 |
| Origin species: | Human |
| Product name: | AVL9-AVL9 homolog (S. cerevisiase) Gene |
| Size: | 2ug |
| Accessions: | BC027724 |
| Gene id: | 23080 |
| Gene description: | AVL9 homolog (S. cerevisiase) |
| Synonyms: | AVL9 cell migration associated; AVL9 homolog (S. cerevisiase); late secretory pathway protein AVL9 homolog; KIAA0241 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagaaggccaggagaggcggggatggcgtcccccgggggcccgtactgcacatcgtggtggtcggatttcaccacaagaagggctgccaggttgaattctcttacccgcccctgattccaggagatggacatgacagccacactttacctgaagaatggaagtatttgcccttccttgccttaccagatggcgcacacaactaccaggaagatactgtgttttttcacttgccacccagaaatggaaatggagccacagtatttggtatctcttgctatcgacaaattgaagccaaggcactgaaagtaaggcaagcagatatcaccagagagactgttcagaaaagtgtctgtgttctaagcaagctgcctctgtatggtttacttcaagcaaaacttcaactcattacacatgcatattttgaagagaaggatttttcccaaatttctattctaaaggagctttatgaacatatgaatagttccttgggaggtgcttcattagaaggatcccaagtatatcttggtctgtcacctcgagatcttgtccttcattttcgacacaaggtcttaatcctatttaagctaattcttcttgaaaaaaaggttcttttttatatttctccagtgaataaattggtgggtgcactgatgactgtgttatccctttttccaggcatgattgaacatggtctcagtgactgttctcagtatagaccccggaaaagtatgtctgaagatggtgggcttcaggaaagtaacccatgtgcagatgattttgtttctgcatccactgctgatgtttcacataccaacttgggaactatcaggaaagtcatggcaggaaaccatggagaagatgctgccatgaagactgaggagcctttgttccaagtggaagacagcagcaaagggcaggaacccaatgataccaatcaatatttgaaacctccatctcgcccatctccagattcttcagaaagtgactgggaaactttggatcctagtgtcttagaggaccccaacttgaaagaaagggaacagctgggatcagaccagacaaatttgtttccaaaggactctgtcccctcagagagtcttccaattactgtacaacctcaagctaatacgggacaggtagtcctgataccagggctcatttcgggtttggaagaggatcagtatggcatgcccctggccatcttcacaaagtgtacccaagatgtcttacctcaggcaaatcacagcttcaagtttttgataacggataggagaatcacaccaagaccacttcgaagaaggctggtttctgctacactaacaaatatgcttcaagagaagagttgctggaaaaaacacatcaagtgtagaagacgtgttcaaaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - H2A histone family, member Z - immunoglobulin kappa constant - immunoglobulin kappa constant - histamine N-methyltransferase |