Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FOXP2-forkhead box P2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FOXP2-forkhead box P2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018016 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FOXP2 |
| Origin species: | Human |
| Product name: | FOXP2-forkhead box P2 Gene |
| Size: | 2ug |
| Accessions: | BC018016 |
| Gene id: | 93986 |
| Gene description: | forkhead box P2 |
| Synonyms: | CAGH44; SPCH1; TNRC10; forkhead box protein P2; CAG repeat protein 44; forkhead/winged-helix transcription factor; trinucleotide repeat containing 10; trinucleotide repeat-containing gene 10 protein; forkhead box P2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgcaggaatctgcgacagagacaataagcaacagttcaatgaatcaaaatggaatgagcactctaagcagccaattagatgctggcagcagagatggaagatcaagtggtgacaccagctctgaagtaagcacagtagaactgctgcatctgcaacaacagcaggaggatgttgtctcttacacccaggttatttgttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serum amyloid A2 - apolipoprotein M - F-box protein 8 - F-box protein 6 |