> >>MGC27345-hypothetical protein MGC27345 Gene
MGC27345-hypothetical protein MGC27345 Gene View larger

MGC27345-hypothetical protein MGC27345 Gene

PTXBC024231

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of MGC27345-hypothetical protein MGC27345 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC27345-hypothetical protein MGC27345 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024231
Product type: DNA & cDNA
Ncbi symbol: MGC27345
Origin species: Human
Product name: MGC27345-hypothetical protein MGC27345 Gene
Size: 2ug
Accessions: BC024231
Gene id: 157247
Gene description: hypothetical protein MGC27345
Synonyms: uncharacterized protein MGC27345
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccacaaagcgaagaacacctcttggaggcagagcccctcagccctatccaggccagcagtgtccacttgaaatctgaaagcagcctccctcaccaaaccagcaagatggaaaacctccctgggttggcaagtggccctgggaagtacatgccccatctctgtcaggatagcagtggagaggtttcgtgccagtgccagctccacccacccagatggtactcaagactccaagcctgtcaatggggtggaaactttctggcattttctgtcagaagggtgagttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein MGC24125
- hemochromatosis type 2 (juvenile)
- retinoblastoma binding protein 6
- chloride intracellular channel 2

Reviews

Buy MGC27345-hypothetical protein MGC27345 Gene now

Add to cart