MPHOSPH6-M-phase phosphoprotein 6 Gene View larger

MPHOSPH6-M-phase phosphoprotein 6 Gene

PTXBC029395

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MPHOSPH6-M-phase phosphoprotein 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MPHOSPH6-M-phase phosphoprotein 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029395
Product type: DNA & cDNA
Ncbi symbol: MPHOSPH6
Origin species: Human
Product name: MPHOSPH6-M-phase phosphoprotein 6 Gene
Size: 2ug
Accessions: BC029395
Gene id: 10200
Gene description: M-phase phosphoprotein 6
Synonyms: MPP; MPP-6; MPP6; M-phase phosphoprotein 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccgagagaaagacaaagttgtccaagaatctgctgcgcatgaagtttatgcaaaggggactggactcagaaaccaagaaacaactagaagaagaagaaaagaaaatcattagtgaagagcactggtacttggatttgccagagcttaaagagaaagagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Vpr (HIV-1) binding protein
- GLI pathogenesis-related 2
- transmembrane protein 182
- transmembrane protein 135

Reviews

Buy MPHOSPH6-M-phase phosphoprotein 6 Gene now

Add to cart